Page 17 - SPEMD_60-4
P. 17

rev port estomatol med dent cir maxilofac . 2019;60(4):163-168         165



            Table 1. PCR conditions, regarding primers’ sequence of housekeeping gene and viruses, and their respective fragment
            size (bp, base pairs)
                                                                  Primers (5’-3’)
              Virus       PCR Conditions                                                            Fragment (bp)
                                                      Sense                      Antisense

                     94°C/ 2 min, 94°C/ 30 sec (40x),
            β-globin  60°C/ 45 sec, 72°C/ 1 min,                       TCACCACCAACTTCATCCAGCTTCACC      123
                     72°C/ 5 min.           CTTCTGACACAACTGTGTTCACTAGC
                     94°C/ 2 min, 94°C/ 30 sec (40x),
            HSV-1    60°C/ 45 sec, 68°C/ 30 sec,   TGGGACACATGCCTTCTTGG  ACCCTTAGTCAGACTCTGTTACTTACCC   147
                     72°C/ 5 min.
                     94°C/ 2 min, 94°C/ 30 sec (40x),
            HSV-2    60°C/ 45 sec, 68°C/ 30 sec,   CGCTTCATCATGGGC          GTACAGACCTTCGGAGG           227
                     72°C/ 5 min.
                     94°C/ 2 min, 94°C/ 30 sec (40x),
            EBV      60°C/ 45 sec, 68°C/ 30 sec,   GTGTTCGACTTTGCCAGCCTCTAC  ACTCGTGCACGTGCTTCTTTAC     176
                     72°C/ 5 min.
                     94°C/ 2 min, 94°C/ 30 sec (40x),
            CMV      60°C/ 45 sec, 68°C/ 30 sec,   GTGTTCGACTTTGCCAGCCTCTAC  TTGACACTCGCGCATGCATTC      242
                     72°C/ 5 min.
                                                                                                             19
                                                                                                  Source: Adapted .
           Scale of the World Health Organization (WHO),  where grades   with 0.8 μL of ethidium bromide (1μg/μL), in TBE 1X (tris +
                                               16
           1 and 2 correspond to moderate mucositis and grades 3 and 4   boric acid 0.089 M and EDTA 0.02 M) and visualized in a tran-
           to severe mucositis. 17                             silluminator under UV light, under electrical tension of 80 to
              For the evaluation of HSV-1, EBV and CMV, samples were col-  100 Volts. The size of amplified PCR fragments was determined
           lected from the buccal mucosa and submitted to PCR analysis   by comparison with molecular weight markers (100 bp ready-
                                                                                   ®
           regardless of the presence of buccal mucositis. The patient’s   to-use DNA Ladder, Bioron ).
           mouth rinsed with sterile water and then the samples were ob-
           tained via oral swabs from the cheek mucosa (from molars to
           incisors), bilaterally, after brushing the mucosa with sterile cervi-  Results
                          ®
           cal brushes (Kolplast  Commercial Industrial do Brasil Ltda) from
                       10
           5 to 10 seconds.  The buccal evaluation and swabs were planned   From September 2014 to January 2015, nine consecutive ALL
           to be performed on days 0/1 (D0/D1), 8 (D8), 15 (D15) and 35 (D35)   cases of children and adolescents were analyzed, with a prev-
           of the pre-phase and induction phase (P/I) and days 1(D1), 15 (D15),   alence peak at around 2 years of age (66.7%), in males (66.7%)
           29 (D29) and 50 (D50) of the consolidation of remission phase (CR).  and with B-cell ALL diagnosis (55.6%). Clinical data regarding
              The samples were transferred to 1.5 mL microtubes with 500   gender, age and subtype of ALL from the nine cases can be
           μL of TE buffer (10 mM Tris HCl and 1 mM EDTA, pH 8.0) and   found in Table 2.
           stored at -20ºC. For the DNA extraction, 500 μL of TPK (10 mg/mL
           proteinase K, plus TE buffer and Tween 20%) were added to the   Table 2. Clinical profile of ALL patients in treatment at
           tubes. The microtubes were briefly submitted to a vortex to ho-  HEMOAM from September 2014 to January 2015
           mogenize the mix and then were incubated at 56°C for an hour,
           followed by ten more minutes at 100°C to activate the proteinase   Clinical Characteristics  Number of   Percentage
                                                                                         cases (n=9)
           K. Afterwards, the DNA concentration was obtained via absor-
           bance reading at 260 nm. The microtubes were stored at -20°C.  Gender
              Specific sets of initiation pairs were used for the amplifi-    Male          6 3        66.7%
                                                                                                       33.3%
                                                                  Female
           cation and detection of HSV-1, EBV and CMV via PCR analy-
              19
           sis.  The same samples were submitted to PCR for the β-globin   Age
           constitutive gene to control the occurrence of false-positive     2 years        6          66.7%
           results. The positive controls for HSV-1, EBV and CMV were     7 years           1 1        11.1%
                                                                  9 years
                                                                                                       11.1%
           provided by the Tropical Medicine Foundation of Amazonas.     14 years           1          11.1%
           Ultrapure water associated with the reaction’s reagents was
           used for negative controls.                          ALL                         5          55.6%
                                                                  Low Risk of Recurrence B-cell
              The PCR reactions for β-globin, HSV-1, EBV and CMV were     High Risk of Recurrence B-cell  3  33.3%
           performed in PCR conditions and primers according to Table 1.    T-cell          1          11.1%
              All of the PCR reactions were performed in Thermal Cycler     PH+             0           0%
           (Applied Biosystems  Veriti  Thermal Cycler). The amplicons   ALL PH+: Acute lymphocytic leukemia positive for Philadelphia
                                 ®
                           ®
           were analyzed by electrophoresis in 2% agarose gel, stained   chromosome.
   12   13   14   15   16   17   18   19   20   21   22